Class 12

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 9 Strategies for Enhancement in Food Production Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 9 Strategies for Enhancement in Food Production

PSEB 12th Class Biology Guide Strategies for Enhancement in Food Production Textbook Questions and Answers

Question 1.
Explain in brief the role of animal husbandry in human welfare.
Answer:
Animal husbandry deals with the scientific management of livestock. It includes various aspects such as feeding, breeding, and control diseases to raise the population of animal livestock. Animal husbandry usually includes animals such as cattle, pig, sheep, poultry, honeybee, silkworm and fish which are useful for humans in various ways. These animals are managed for the production of commercially important products such as milk, meat, wool, egg, honey, silk, etc. The increase in human population has increased the demand of these products. Hence, it is necessary to improve the management of livestock scientifically.

Question 2.
If your family owned a dairy farm, what measures would you undertake to improve the quality and quantity of milk production?
Answer:
Dairy farm management deals with processes which aim at improving the quality and quantity of milk production. Milk production is primarily dependent on choosing improved cattle breeds, provision of proper feed for cattle, maintaining proper shelter facilities, and regular cleaning of cattle.

Choosing improved cattle breeds is an important factor of cattle management. Hybrid cattle breeds are produced for improved productivity. Therefore, it is essential that hybrid cattle breeds should have a combination of various desirable genes such as high milk production and high resistance to diseases. Cattle should also be given healthy and nutritious food consisting of roughage, fibre concentrates, and high levels of proteins and other nutrients.

Cattle should be housed in proper cattle-houses and should be kept in well ventilated roofs to prevent them from harsh weather conditions such as heat, cold, and rain. Regular baths and proper brushing should be ensured to control diseases. Also, time-to-time check ups by a veterinary doctor for symptoms of various diseases should be undertaken.

Question 3.
What is meant by the term ‘breed’? What are the objectives of animal breeding?
Answer:
A breed is a special variety of animals within a species. It is similar in most characters such as general appearance, size, configuration, and features with other members of the same species. Jersey and Brown
Swiss are examples of foreign breeds of cattle. These two varieties of cattle have the ability to produce abundant quantities of milk. This milk is very nutritious with high protein content.
Objectives of animal breeding are as follows:

• To increase thd yield of animals.
• To improve the desirable qualities of the animal produce.
• To produce disease-resistant varieties of animals.

Question 4.
Name the methods employed in animal breeding. According to you which of the methods is best? Why?
Answer:
Animal breeding is the method of mating closely related individuals. There are several methods employed in animal breeding, which can be classified into the following categories:

(A) Natural Methods of Breeding Include Inbreeding and Out-breeding : Breeding between animals of the same breed is known as inbreeding, while breeding between animals of different breeds is known as out-breeding. Out-breeding of animals is of three types:
(a) Out-crossing: In this type of out-breeding, the mating of animals occurs within the same breed. Thus, they have no common ancestors up to the last 4-5 generations.

(b) Cross-breeding: In this type of out-breeding, the mating occurs between different breeds of the same species, thereby producing a hybrid.

(c) Interspecific hybridisation: In this type of out-breeding, the mating occurs between different species.

(B) Artificial Methods of Breeding Include Modern Techniques of Breeding : It involves controlled breeding experiments, which are of two types:
(a) Artificial insemination : It is a process of introducing the semen (collected from the male) into the oviduct or the uterus of the female body by the breeder. This method of breeding helps the breeder overcome certain problems faced in abnormal mating.

(b) Multiple ovulation embryo technology (MOET) : It is a technique for cattle improvement in which super-ovulation is induced by a hormone injection. Then, fertilisation is achieved by artificial insemination and early embryos are collected. Each of these embryos are then transplanted into the surrogate mother for further development of the embryo.

The best method to carry out animal breeding is the artificial method of breeding, which includes artificial insemination and MOET technology. These technologies are scientific in nature. They help overcome problems of normal mating and have a high success rate of crossing between mature males and females. Also, it ensures the production of hybrids with the desired qualities. This method is highly economical as a small amount of semen from the male can be used to inseminate several cattle.

Question 5.
What is apiculture? How is it important in our lives?
Answer:
Apiculture is the practise of bee-keeping for the production of various products such as honey, bee’s wax, etc. Honey is a highly nutritious food source and is used as an indigenous system of medicines. It is
useful in the treatment of many disorders such as cold, flu, and 1 dysentery. Other commercial products obtained from honey bees include bee’s wax and bee pollen. Bee’s wax is used for making cosmetics, polishes, and is even used in several medicinal preparations. Therefore, to meet the increasing demand of honey, people have started practicing bee-keeping on a large scale. It has become an f income generating activity for farmers since it requires a low investment and is labour intensive.

Question 6.
Discuss the role of fishery in enhancement of food production.
Answer:
Fishery is an industry which deals with catching, processing, and marketing of fishes and other aquatic animals that have a high economic value. Some commercially important aquatic animals are prawns, crabs, oysters, lobsters, and octopus. Fisheries play an important role in the Indian economy. This is because a large part of the Indian population is dependent on fishes as a source of food, which is both cheap and high in animal protein. Fishery is an employment generating industry especially for people staying in the coastal areas. Both fresh water fishes (such as Catla, Rohu, etc.) and marine fishes (such as tuna, mackerel, pomfret, etc.) are of high economic value.

Question 7.
Briefly describe various steps involved in plant breeding.
Answer:
Plant breeding is the process in which two genetically dissimilar varieties are purposely crossed to produce a new hybrid variety. As a result, characteristics from both parents can be obtained in the hybrid plant variety. Thus, it involves the production of a new variety with the desired characteristics such as resistance to diseases, climatic adaptability, and better productivity. The various steps involved in plant breeding are as follows:

(a) Collection of Genetic Variability: Genetic variability from various wild relatives of the cultivated species are collected to maintain the genetic diversity of a species. The entire collection of the diverse alleles of a gene in a crop is called the germplasm collection.

(b) Evaluation of Germplasm and Selection of Parents: The germplasm collected is then evaluated for the desirable genes. The selected plants with the desired genes are then used as parents in plant breeding experiments and are multiplied by the process of hybridisation.

(c) Cross-hybridisation between Selected Parents: The next step in plant breeding is to combine the desirable characters present in two different parents to produce hybrids. It is a tedious job as one has to ensure that the pollen grains collected from the male parent reach the stigma of the female parent.

(d) Selection of Superior Hybrids: The progenies of the hybrids having the desired characteristics are selected through scientific evaluation. The selected progenies are then self-pollinated for several generations to ensure homozygosity.

(e) Testing, Release, and Commercialisation of New Cultivars: The selected progenies are evaluated for characters such as yield, resistance to diseases, performance, etc. by growing them in research fields for at least three growing seasons in different parts of the country. After thorough testing and evaluation, the selected varieties are given to the farmers for growing in fields for a large-scale production.

Question 8.
Explain what is meant by biofortification.
Answer:
Biofortification is a process of breeding crops with higher levels of vitamins, minerals, proteins, and fat content. This method is employed to improve public health. Breeding of crops with improved nutritional quality is undertaken to improve the content of proteins, oil, vitamins, minerals, and micro-nutrients in crops. It is also undertaken to upgrade the quality of oil and proteins. An example of this is a wheat variety known as Atlas 66, which has high protein content in comparison to the existing wheat. In addition, there are several other improved varieties of crop plants such as rice, carrots, spinach etc. which have more nutritious value and more nutrients than the existing varieties.

Question 9.
Which part of the plant is best suited for making virus-free plants and why?
Answer:
Apical and axillary meristems of plants is used for making virus-free plants. In a diseased plant, only this region is not infected by the virus as compared to the rest of the plant region. Hence, the scientists remove axillary and apical meristems of the diseased plant and grow it in vitro to obtain a disease-free and healthy plant.
Virus-free plants of banana, sugarcane, and potato have been obtained using this method by scientists.

Question 10.
What is the major advantage of producing plants by micropropagation?
Answer:
Micropropagation is a method of producing new plants in a short duration using plant tissue culture.
Some major advantages of micropropagation are as follows:

• Micropropagation helps in the propagation of a large number of plants in a short span of time.
• The plants produced are identical to the mother plant.
• It leads to the production of healthier plantlets, which exhibit better disease-resisting powers.

Question 11.
Find out what the various components of the medium used for propagation of an explant in vitro are?
Answer:
The major components of medium used for propagation of explants in vitro are carbon sources such as sucrose, inorganic salts, vitamins, amino acids, water, agar-agar, and certain growth hormones such as auxins, gibberellins and cytokinins etc.

Question 12.
Name any five hybrid varieties of crop plants which have been developed in India.
Answer:
The five hybrid varieties of crop plants which have been developed in India are as follow:

Crop plant	Hybrid variety
Wheat	Sonalika and Kalyan Sona
Rice	Jaya and Ratna
Cauliflower	Pusa Shubhra and Pusa Snowball K-1
Cowpea	Pusa Komal
Mustard	Pusa Swarnim

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 8 Human Health and Disease Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 8 Human Health and Disease

PSEB 12th Class Biology Guide Human Health and Disease Textbook Questions and Answers

Question 1.
What are the various public health measures, which you would suggest as safeguard against infectious diseases?
Answer:
Public health measures are preventive measures which are taken to check the spread of various infectious diseases. These measures should be taken to reduce the contact with infectious agents.
Some of these methods are as follows:
1. Maintenance of Personal and Public Hygiene: It is one of the most important methods of preventing infectious diseases. This measure includes maintaining a clean body, consumption of healthy and nutritious food, drinking clean water, etc. Public hygiene includes proper disposal of waste material, excreta, periodic cleaning, and disinfection of water reservoirs.

2. Isolation: To prevent the spread of air-borne diseases such as pneumonia, chicken pox, tuberculosis, etc., it is essential to keep the infected person in isolation to reduce the chances of spreading these diseases.

3. Vaccination: Vaccination is the protection of the body from communicable diseases by administering some agent that mimics the microbe inside the body. It helps in providing passive immunisation to the body. Several vaccines are available against many diseases such as tetanus, polio, measles, mumps, etc.

4. Vector Eradication: Various diseases such as malaria, filariasis, dengue, and chikungunya spread through vectors. Thus, these diseases can be prevented by providing a clean environment and by preventing the breeding of mosquitoes. This can be achieved by not allowing water to stagnate around residential areas. Also, measures like regular cleaning of coolers, use of mosquito nets and insecticides such as malathion in drains, ponds, etc. can be undertaken to ensure a healthy environment. Introducing fish such as Gambusia in ponds also controls the breeding of mosquito larvae in stagnant water.

Question 2.
In which way has the study of biology helped us to control infectious diseases?
Answer:
Various advancements that have occurred in the field of biology have helped us gain a better understanding to fight against various infectious diseases. Biology has helped us study the life cycle of various parasites, pathogens, and vectors along with the modes of transmission of various diseases and the measures for controlling them. Vaccination programmes against several infectious diseases such as small pox, chicken pox, tuberculosis, etc. have helped to eradicate these diseases. Biotechnology has helped in the preparation of newer and safer drugs and vaccines. Antibiotics have also played an important role in treating infectious diseases.

Question 3.
How does the transmission of each of the following diseases take * place?
(a) Amoebiasis
(b) Malaria
(c) Ascariasis
(d) Pneumonia
Answer:

Disease	Causative organism	Mode of transmission
a. Amoebiasis	Entamoeba histolytica	It is a vector-borne disease that spreads by the means of contaminated food and water. The vector involved in the transmission of this disease is the housefly.
b. Malaria	Plasmodium sp.	It is a vector-borne disease that spreads by the biting of the female Anopheles mosquito.
c. Ascariasis	Ascaris lumbricoides	It spreads via contaminated food and water.
d. Pneumonia	Streptococcus pneumoniae	It spreads by the sputum of an infected person.

Question 4.
What measure would you take to prevent water-borne diseases?
Answer:
Water-borne diseases such as cholera, typhoid, hepatitis B, etc. spread by drinking contaminated water. These water-borne diseases can be prevented by ensuring proper disposal of sewage, excreta, periodic cleaning. Also, measures such as disinfecting community water reservoirs, boiling drinking water, etc. should be observed.

Question 5.
Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.
Answer:
‘A suitable gene’ refers to a specific DNA segment which can be injected into the cells of the host body to produce specific proteins. This protein kills the specific disease-causing organism in the host body and provides immunity.

Question 6.
Name the primary and secondary lymphoid organs.
Answer:

• Primary lymphoid organs include the bone marrow and the thymus.
• Secondary lymphoid organs include the spleen, lymph nodes, tonsils, Peyer’s patches of small intestine, and appendix.

Question 7.
The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its full form:
(a) MALT
(b) CMI
(c) AIDS
(d) NACO
(e) HIV
Answer:
(a) MALT: Mucosa-Associated Lymphoid Tissue
(b) CMI: Cell-Mediated Immunity
(c) AIDS: Acquired Immuno Deficiency Syndrome
(d) NACO: National AIDS Control Organisation
(e) HIV: Human Immuno Deficiency Virus

Question 8.
Differentiate the following and give examples of each:
(a) Innate and acquired immunity
(b) Active and passive immunity
Answer:
(a) Innate and acquired immunity

Innate immunity	Acquired immunity
1. It is a non-pathogen specific type of defense mechanism.	It is a pathogen specific type of defense mechanism.
2. It is inherited from parents and protects the individual since birth.	It is acquired after the birth of an individual.
3. It operates by providing barriers against the entry of foreign infectious agents.	It operates by producing primary and secondary responses, which are mediated by B-lymphocytes and T-lymphocytes.
4. It does not have a specific memory.	It is characterised by an immunological memory.

(b) Active and passive immunity

Active immunity	Passive immunity
1. It is a type of acquired immunity in which the body produces its own antibodies against disease-causing antigens.	It is a type of acquired immunity in which readymade antibodies are transferred from one individual to another.
2. It has a long lasting effect.	It does not have long lasting effect.
3. It is slow. It takes time in producing antibodies and giving responses.	It is fast. It provides immediate relief.
4. Injecting microbes through vaccination inside the body is an example of active immunity.	Transfer of antibodies present in the mother’s milk to the infant is an example of passive immunity.

Question 9.
Draw a well-labelled diagram of an antibody molecule.
Answer:

Question 10.
What are the various routes by which transmission of human i immuno-deficiency virus takes place?
Answer:
AIDS (Acquired Immuno-Deficiency Syndrome) is caused by the Human I Immuno-deficiency Virus (HIV).
It has the following modes of transmission:

• Unprotected sexual contact with an infected person.
• Transfusion of blood from an infected person to a healthy person.
• Sharing infected needles and syringes.
• From an infected mother to a child through the placenta.

Question 11.
What is the mechanism by which the AIDS virus causes . deficiency of immune system of the infected person?
Answer:
AIDS (Acquired Immuno-Deficiency Syndrome) is caused by the Human immuno-deficiency virus (HIV) via sexual or blood-blood contact. After entering the human body, the HIV virus attacks and enters the macrophages. Inside the macrophages, the RNA of the virus replicates ’ with the help of enzyme reverse transcriptase and gives rise to viral
DNA. Then, this viral DNA incorporates into the host DNA and directs the synthesis of virus particles. At the same time, HIV enters helper T-lymphocytes. It replicates and produces viral progeny there. These newly formed progeny viruses get released into the blood, attacking p other healthy helper T-lymphocytes in the body. As a result, the number of T-lymphocytes in the body of an infected person decreases progressively, thereby decreasing the immunity of a person.

Question 12.
How is a cancerous cell different from a normal cell?
Answer:

Normal cell	Cancerous cell
1. Normal cells show the property of contact inhibition. Therefore, when these cells come into contact with other cells, they stop dividing.	Cancerous cells lack the property of contact inhibition. Therefore, they continue to divide, thereby forming a mass of cells or tumor.
2. They undergo differentiation after attaining a specific growth.	They do not undergo differentiation.
3. These cells remain confined at a particular location.	These cells do not remain confined at a particular location. They move into neighbouring tissues and disturb its function.

Question 13.
Explain what is meant by metastasis.
Answer:
The property of metastasis is exhibited by malignant tumors. It is the pathological process of spreading cancerous cells to the different parts of the body. These cells divide uncontrollably, forming a mass of cells called tumor. From the tumor, some cells get sloughed off and enter into the blood stream. From the blood stream, these cells reach distant parts of the body and therefore, initiate the formation of new tumors by dividing actively.

Question 14.
List the harmful effects caused by alcohol/drug abuse.
Answer:
Alcohol and drugs have several adverse effects on the individual, his family, and the society.
A. Effects of Alcohol
Effects on the Individual: Alcohol has an adverse effect on the body of an individual. When an individual consumes excess alcohol, it causes damage to the liver and the nervous system. As a result, other symptoms such as depression, fatigue, aggression, loss of weight and appetite may also be observed in the individual. Sometimes, extreme levels of alcohol consumption may also lead to heart failure, resulting coma and death. Also, it is advisable for pregnant women to avoid alcohol as it may inhibit normal growth of the baby.

Effects on the Family: Consumption of excess alcohol by any family member can have devastating effects on the family. It leads to several domestic problems such as quarrels, frustrations, insecurity, etc. Effects on the Society:

• Rash behaviour
• Malicious mischief and violence
• Deteriorating social network
• Loss of interest in social and other activities

B. Effects of Drugs
Effects on the Individual: Drugs have an adverse effect on the central nervous system of an individual. This leads to the malfunctioning of several other organs of the body such as the kidney, liver, etc. The spread of HIV is most common in these individuals as they share common needles while injecting drugs in their body. Drugs have long-term side effects on both males and females. These side effects include increased aggressiveness, mood swings, and depression.

Effects on the Family and Society: A person addicted to drugs creates problems for his family and society. A person dependant on drugs becomes frustrated, irritated, and anti-social.

Question 15.
Do you think that friends can influence one to take alcohol/ drugs? If yes, how may one protect himself/herself from such an influence?
Answer:
Yes, friends can influence one to take drugs and alcohol. A person cart take the following steps for protecting himself/herself against alcohol/ drug abuse:
(a) Increase your willpower to stay away from alcohol and drugs. One should not experiment with alcohol for curiosity and fun.

• Avoid the company of friends who take drugs.
• Seek help from parents and peers. ‘
• Take proper knowledge and counselling about drug abuse. Devote your energy in other extra-curricular activities.
• Seek immediate professional and medical help from psychologists and psychiatrists if symptoms of depression and frustration become apparent.

Question 16.
Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher. Ans. Drug and alcohol consumption has an inherent addictive nature associated with euphoria and a temporary feeling of well-being. Repeated intake of drugs increases the tolerance level of the body’s receptors, leading to more consumption of drugs.

A. Effects of Alcohol
Effects on the Individual: Alcohol has an adverse effect on the body of an individual. When an individual consumes excess alcohol, it causes damage to the liver and the nervous system. As a result, other symptoms such as depression, fatigue, aggression, loss of weight and appetite may al“so be observed in the individual. Sometimes, extreme levels of alcohol consumption may also lead to heart failure, resulting coma and death. Also, it is advisable for pregnant women to avoid alcohol as it may inhibit normal growth of the baby.

Effects on the Family: Consumption of excess alcohol by any family member can have devastating effects on the family. It leads to several domestic problems such as quarrels, frustrations, insecurity, etc. Effects on the Society:

• Rash behaviour
• Malicious mischief and violence
• Deteriorating social network
• Loss of interest in social and other activities

B. Effects of Drugs
Effects on the Individual: Drugs have an adverse effect on the central nervous system of an individual. This leads to the malfunctioning of several other organs of the body such as the kidney, liver, etc. The spread of HIV is most common in these individuals as they share common needles while injecting drugs in their body. Drugs have long-term side effects on both males and females. These side effects include increased aggressiveness, mood swings, and depression.

Effects on the Family and Society: A person addicted to drugs creates problems for his family and society. A person dependant on drugs becomes frustrated, irritated, and anti-social.

Question 15.
Do you think that friends can influence one to take alcohol/ drugs? If yes, how may one protect himself/herself from such an influence?
Answer:
Yes, friends can influence one to take drugs and alcohol. A person cart take the following steps for protecting himself/herself against alcohol/ drug abuse:

• Increase your willpower to stay away from alcohol and drugs. One should not experiment with alcohol for curiosity and fun.
• Avoid the company of friends who take drugs.
• Seek help from parents and peers.
• Take proper knowledge and counselling about drug abuse. Devote your energy in other extra-curricular activities.
• Seek immediate professional and medical help from psychologists and psychiatrists if symptoms of depression and frustration become apparent.

Question 16.
Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.
Answer:
Drug and alcohol consumption has an inherent addictive nature associated with euphoria and a temporary feeling of well-being. Repeated intake of drugs increases the tolerance’ level of the body’s receptors, leading to more consumption of drugs.

Question 17.
In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided?
Answer:
Many factors are responsible for motivating youngsters towards alcohol or drugs. Curiosity, need for adventure and excitement, experimentation are the initial causes of motivation. Some youngsters start consuming drugs and alcohol in order to overcome negative emotions (such as stress, pressure, depression, frustration) and to excel in various fields. Several mediums like television, internet, newspaper, movies etc. are also responsible for promoting the idea of alcohol to the younger generation. Amongst these factors, reasons such as unstable and unsupportive family structures and peer pressure can also lead an individual to be dependant on drugs and alcohol.

Preventive measures against addiction of alcohol and drugs are as follows:

• Parents should motivate and try to increase the willpower of their child.
• Parents should educate their children about the ill-effects of alcohol. They should provide them with proper knowledge and counselling regarding the consequences of addiction to alcohol.
• It is the responsibility of the parent to discourage a child from experimenting with alcohol. Youngsters should be kept away from the company of friends who consume drugs.
• Children should be encouraged to devote their energy in other extra¬curricular and recreational activities.
• Proper professional and medical help should be provided to a child if sudden symptoms of depression and frustration are observed.

Punjab State Board PSEB 12th Class Physics Book Solutions Chapter 15 Communication Systems Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Physics Chapter 15 Communication Systems

PSEB 12th Class Physics Guide Communication Textbook Questions and Answers

Question 1.
Which of the frequencies will be suitable for beyond-the-horizon communication using sky waves?
(a) 10 kHz
(b) 10 MHz
(C) 1 GHz
(d) 1000 GHz
Answer:
(b) 10 MHz.
For beyond-the-horizon communication, it is necessary for the signal waves to travel a large distance. 10 kHz signals cannot be radiated efficiently because of the antenna size. The high-energy signal waves (1 GHz – 1000 GHz) penetrate the ionosphere. 10 MHz frequencies get reflected easily from the ionosphere. Hence, signal waves of such frequencies are suitable for beyond-the-horizon communication.

Question 2.
Frequencies in the UHF range normally propagate by means of:
(a) Ground waves
(b) Sky waves
(c) Surface waves
(d) Space waves
Answer:
(d) Space waves
Owing to its high frequency, an ultra-high frequency (UHF) wave can neither travel along the trajectory of the ground nor can it get reflected by the ionosphere. The signals having UHF are propagated through line-of-sight communication, which is nothing but space wave propagation.

Question 3.
Digital signals
(i) do not provide a continuous set of values,
(ii) represent values as discrete steps,
(iii) can utilize binary system, and
(iv) can utilize decimal as well as binary systems.
Which of the above statements are true?
(a) (i) and (ii) only
(b) (ii) and (iii) only
(c) (i), (ii) and (iii) but not (iv)
(d) All of (i), (ii), (iii) and (iv)
Answer:
(c) A digital signal uses the binary (0 and 1) system for transferring message signals. Such a system cannot utilize the decimal system (which corresponds to analogue signals). Digital signals represent discontinuous values.

Question 4.
Is it necessary for a transmitting antenna to be at the same height as that of the receiving antenna for line-of-sight communication? A TV transmitting antenna is 81 m tall. How much service area can it cover if the receiving antenna is at the ground level?
Answer:
Line-of-sight communication means that there is no physical obstruction between the transmitter and the receiver.
In such communications, it is not necessary for the transmitting and receiving antennas to be at the same height.
Height of the given antenna, h = 81 m
Radius of earth, R = 6.4 x 10⁶ m

For range, d = 2Rh, the service area of the antenna is given by the relation
A = πd² = π(2Rh)
= 3.14 x 2 x 6.4 x 10⁶ x 81
= 3255.55 x 10⁶ m²
= 3255.55 ~ 3256 km².

Question 5.
A carrier wave of peak voltage 12 V is used to transmit a message signal.
What should be the peak voltage of the modulating signal in order to have a modulation index of 75%?
Answer:
Amplitude of the carrier wave, A_c =12,
Modulation index, m = 75% = 0.75
Amplitude of the modulating wave = A_m

Using the relation for modulation index,
m = \(\frac{A_{m}}{A_{c}}\)
∴ A_m =mA_c
= 0.75 x 12 = 9 V
Hence, amplitude of the modulating wave is 9 V.

Question 6.
A modulating signal is a square wave, as shown in Fig. 15.14.
The carrier wave is given by c(t) = 2 sin (8πt) volts.

(i) Sketch the amplitude modulated waveform.
(ii) What is the modulation index?
Answer:
Given, the equation of carrier wave
c(t) = 2sin(8πt) ……………………………… (i)
(i) According to the diagram.
Amplitude of modulating signal, A_m = 1V
Amplitude of carrier wave,
A_c = 2V [By eq.(1)]
T_m = 1s (From diagram)
From eq.(1) ω_m = \(\frac{2 \pi}{T_{m}}=\frac{2 \pi}{1}\) = 2π rad/s ………………. (2)
c(t) = 2sin8πt = Ac sinω_c t
ω_c =8π
So,
From Eq.(2)
So, ω_c = 4ω_m
Amplitude of modulated wave
A = A_m +A_c =2+1 =3V
The sketch of the amplitude modulated waveform is shown below :
For carrier signal, ω = 8π,T = \(\frac{2 \pi}{\omega}=\frac{2}{8}=\frac{1}{4}\) = 0.25s

(ii) Modulation index, µ = \(\frac{A_{m}}{A_{c}}=\frac{1}{2}\) = 0.5

Question 7.
For an amplitude modulated wave, the maximum amplitude is found to be 10 V while the minimum amplitude is found to be 2 V. Determine the modulation index, p.
What would be the value of p if the minimum amplitude is zero volts?
Answer:
Maximum amplitude, A_max = 10 V
Minimum amplitude, A_min = 2 V
Modulation index µ, is given by the relation
µ = \(\frac{A_{\max }-A_{\min }}{A_{\max }+A_{\min }}\)
= \(\frac{10-2}{10+2}=\frac{8}{12} \) = 0.67
If A_min=0,
Then µ = \(\frac{A_{\max }}{A_{\max }}=\frac{10}{10}\) = 1
Hence, µ = 1, if the minimum amplitude is zero volts.

Question 8.
Due to economic reasons, only the upper sideband of an AM wave is transmitted, but at the receiving station, there is a facility for generating the carrier. Show that if a device is available which can multiply two signals, then it is possible to recover the modulating signal at the receiver station.
Answer:
Let ω_c be the angular frequency of carrier waves and com by the angular frequency of signal waves.
Let the signal received at the receiving station be
e = E₁ cos(ω_c +ω_m )t
Let the instantaneous voltage of carrier wave
e_c = E_c cosω_c t
is available at receiving station.
Multiplying these two signals, we get
e x e_c = E₁E_c coscω_c t cos(ω_c+ω_m)t

Now, at the receiving end as the signal passes through filter, it will pass the high frequency (2ω_c + ω_m) but obstruct the frequency ω_m. So, we can \(\frac{E_{1} E_{c}}{2} \cos \omega_{m_{s}} t\) record the modulating signal frequency ω_m.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 7 Evolution Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 7 Evolution

PSEB 12th Class Biology Guide Evolution Textbook Questions and Answers

Question 1.
Explain antibiotic resistance observed in bacteria in light of Darwinian selection theory.
Answer:
Darwinian selection theory states that individuals with favourable variations are better adapted than individuals with less favourable variation. It means that nature selects the individuals with useful variation as these individuals are better evolved to survive in the existing environment. An example of such selection is antibiotic resistance in bacteria. When bacterial population was grown on an agar plate containing antibiotic penicillin, the colonies that were sensitive to penicillin died, whereas one or few bacterial colonies that were resistant to penicillin survived.

This is because these bacteria had undergone chance mutation, which resulted in the evolution of a gene that made them resistant to penicillin drug. Hence, the resistant bacteria multiplied quickly as compared to non-resistant (sensitive) bacteria, thereby increasing their number. Hence, the advantage of an individual over other helps in the struggle for existence.

Question 2.
Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution.
Answer:
Fossils of dinosaurs have revealed the evolution of reptiles in Jurassic period. As a result of this, evolution of other animals such as birds and mammals has also been discovered. However, two unusual fossils recently unearthed in China have ignited a controversy over the evolution of birds. Confuciusomis is one such genus of primitive birds that were crow sized and lived during the Creataceous period in China.

Question 3.
Attempt giving a clear definition of the term species.
Answer:
Species can be defined as a group of organisms, which have the capability to interbreed in order to produce fertile offspring.

Question 4.
Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.)
Answer:
The various components of human evolution are as follows:
(i) Brain capacity
(ii) Posture
(iii) Food/dietary preference and other important features

Question 5.
Find out through internet and popular science articles whether animals other than man has self-consciousness.
Answer:
There are many animals other than humans, which have self-consciousness. An example of an animal being self-conscious is dolphins. They are highly intelligent. They have a sense of self and they also recognise others among themselves and others. They communicate with each other by whistles, tail-slapping, and other body movements.

Not only dolphins, there are certain other animals such as crow, parrot, chimpanzee, gorilla, orangutan, etc., which exhibit self-consciousness.

Question 6.
List 10 modern-day animals and using the internet resources link it to a corresponding ancient fossil. Name both.
Answer:
The modern-day animals and their ancient fossils are listed in the following table:

Animal	Fossil
1. Man	Ramapithecus
2. Horse	Eohippus
3. Dog	Leptocyon
4. amel	Protylopus
5. Elephant	Moerithers
6. Whale	Protocetus
7. Fish	Arandaspis
8. Tetrapods	Icthyostega
9. Bat	Archaeonycteris
10. Giraffe	Palaeotragus

Question 7.
Practise drawing various animals and plants.
Answer:
Ask your teachers and parents to suggest the names of plants and animals and practise drawing them. You can also take help from your book to find the names of plants and animals.

Question 8.
Describe one example of adaptive radiation.
Answer:
Adaptive radiation is an evolutionary process that produces new species from a single, rapidly diversifying lineage. This process occurs due to natural selection. An example of adaptive radiation is Darwin finches, found in Galapagos Island. A large variety of finches is present in Galapagos Island that arose from a single species, which reached this land accidentally. As a result, many new species have evolved, diverged, and adapted to occupy new habitats. These finches have developed different eating habits and different types of beaks to suit their feeding habits. The insectivorous, blood sucking, and other species of finches with varied dietary habits have evolved from a single seed eating finch ancestor.

Question 9.
Can we call human evolution as adaptive radiation?
Answer:
No, human evolution cannot be called adaptive radiation. This is because adaptive radiation is an evolutionary process that produces new species from a single, rapidly diversifying lineage, which is not the case with human evolution. Human evolution is a gradual process that took place slowly in time. It represents an example of anagenesis.

Question 10.
Using various resources such as your school Library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal, say horse.
Answer:
The evolution of horse started with Eohippus during Eocene period. It involved the following evolutionary stages:

1. Gradual increase in body size
2. Elongation of head and neck region
3. Increase in the length of limbs and feet
4. Gradual reduction of lateral digits
5. Enlargement of third functional toe
6. Strengthening of the back
7. Development of brain and sensory organs
8. Increase in the complexity of teeth for feeding on grass

The evolution of horse is represented as follows:

Eohippus: It had a short head and neck. It had four functional toes and a splint of 1 and 5 on each hind limb and a splint of 1 and 3 in each forelimb. The molars were short crowned that were adapted for grinding the plant diet.

Mesohippus: It was slightly taller than Eohippus. It had three toes in each foot.

Merychippus: It had the size of approximately 100 cm. Although it still had three toes in each foot, but it could run on one toe. The side toe did not touch the ground. The molars were adapted for chewing the grass.

Pliohippus: It resembled the modern horse and was around 108 cm tall. It had a single functional toe with splint of 2nd and 4th in each limb.

Equus: Pliohippus gave rise to Equus or the modem horse with one toe in each foot. They have incisors for cutting grass and molars for grinding food.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 6 Molecular Basis of Inheritance Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

PSEB 12th Class Biology Guide Molecular Basis of Inheritance Textbook Questions and Answers

Question 1.
Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer:
Nitrogenous Bases: Adenine, thymine, uracil, and cytosine.
Nucleosides: Cytidine and guanosine.

Question 2.
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer:
According to Chargaffs rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.
% A = % T and % G = % C
If double stranded DNA has 20% of cytosine, then according to the law, it would have 20% of guanine.
Thus, percentage of G + C content = 40%
The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%.

Question 3.
If the sequence of one strand of DNA is written as follows: 5-ATGCATGCATGCATGCATGCATGCATGC-3′
Write down the sequence of complementary strand in 5′ → 3′ direction.
Answer:
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5′- ATGCATGCATGCATGCATGCATGCATGC – 3′
Then, the sequence of complementary strand in 5′-3′ direction will be
3′- TACGTACGTACGTACGTACGTACGTACG – 5′
Therefore, the sequence of nucleotides on DNA polypeptide in 5′-3′ direction is
5′- GCATGCATGCATGCATGCATGCATGCAT – 3′

Question 4.
If the sequence of the coding strand in a transcription unit is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC-3 Write down the sequence of mRNA.
Answer:
If the coding strand in a transcription unit is
5′ – ATGCATGCATGCATGCATGCATGCATGC-3′
Then, the template strand in 3′ to 5′ direction would be
3′ – TACGTACGTACGTACGTACGTACGTACG-5′
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5′ – AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Answer:
Watson and Crick observed that the two strands of DNA are f anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesised daughter strand.

Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication.

Quetion 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:
There are two different types of nucleic acid polymerases.

1. DNA-dependent DNA polymerases
2. DNA-dependent RNA polymerases

The DNA-dependent DNA polymerases use a DNA template strand for synthesising a new strand of DNA, whereas DNA-dependent RNA polymerases use a DNA template strand for synthesising a new strand of RNA.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer:
Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage.

They grew some bacteriophages on a medium containing radioactive phosphorus (³²) to identify DNA and some on a medium containing radioactive sulphur (³⁵S) to identify protein. Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated’from the bacterial cell by blending and then subjected to the process of centrifugation. Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.

Question 8.
Differentiate between the following :
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand Arts,
Answer:
(a) Repetitive DNA and Satellite DNA

Repetitive DNA	Satellite DNA
Repetitive DNA are DNA sequences that contain small segments, which are repeated many times.	Satellite DNA are DNA sequences that contain highly repetitive DNA.

(b) mRNA and tRNA

mRNA	tRNA
1. mRNA or messenger RNA acts as a template for the process of transcription.	tRNA or transfer RNA acts as an adaptor molecule that carries a specific amino acid to mRNA for the synthesis of polypeptide.
2. It is a linear molecule.	It has clover leaf shape.

(c) Template strand and Coding strand

Template strand	Coding strand
1. Template strand of DNA acts as a template for the synthesis of mRNA during transcription.	Coding strand is a sequence of DNA that has the same base sequence as that of mRNA (except thymine that is replaced by uracil in DNA).
2. It runs from 3′ to 5′.	It runs from 5′ to 3′.

Question 9.
List two essential roles of ribosome during translation.
Answer:
The important functions of ribosome during translation are as follows :
(a) Ribosome acts as the site where protein synthesis takes place from individual amino .acids. It is made up of two subunits.
The smaller subunit comes in contact with mRNA and forms a protein synthesising complex whereas the larger subunit acts as an amino acid binding site.

(b) Ribosome acts as a catalyst for forming peptide bond. For example, 23s r-RNA in bacteria acts as a ribozyme.

Question 10.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Answer:
Lac operon is a segment of DNA that is made up of three adjacent structural genes, namely, an operator gene, a promoter gene, and a regulator gene. It works in a coordinated manner to metabolise lactose into glucose and galactose.

In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it. Once the lactose binds to the repressor, RNA polymerase binds to the promoter region. Hence, three structural genes express their product and respective enzymes are produced. These enzymes act on lactose so that lactose is metabolised into glucose and galactose. After sometime, when the level of inducer decreases as it is completely metabolised by enzymes, it causes synthesis of the repressor from regulator gene. The repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped. This type of regulation is known as negative regulation.

Question 11.
Explain (in one or two lines) the function of the following:
(a) Promoter
(b) tRNA
(c) Exons
Answer:
(a) Promoter: Promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase.

(b) tRNA: tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acid to mRNA on ribosome during translation of proteins.

(c) Exons: Exons are coding sequences of DNA in eukaryotes that transcribe for proteins.

Question 12.
Why is the Human Genome project called a mega project?
Answer:
Human genome project was considered to be a mega project because it had a specific goal to sequence every base pair present in the human genome. It took around 13 years for its completion and got accomplished in year 2006. It was a large scale project, which aimed at developing new technology and generating new information in the field of genomic studies. As a result of it, several new areas and avenues have opened up in the field of genetics, biotechnology, and medical sciences. It provided clues regarding the understanding of human biology.

Question 13.
What is DNA fingerprinting? Mention its application.
Answer:
DNA fingerprinting is a technique used to identify and analyse the variations in various individuals at the level of DNA. It is based on variability and polymorphism in DNA sequences.
Applications

1. It is used in forensic science to identify potential crime suspects.
2. It is used to establish paternity and family relationships.
3. It is used to identify and protect the commercial varieties of crops and livestock.
4. It is used to find out the evolutionary history of an organism and trace out the linkages between groups of various organisms.

Question 14.
Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
Answer:
(a) Transcription: It is the process of synthesis of RNA from DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as Mg²⁺.
The three important events that occur during the process of transcription are as follows:

1. Initiation
2. Elongation
3. Termination

The DNA-dependent RNA polymerase and certain initiation factors bind at the double stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the DNA and leads to the unwinding of DNA duplex into two separate strands. Then, one of the strands, called sense strand, acts as template for mRNA synthesis. The enzyme, RNA polymerase, utilises nucleoside triphosphates (dNTPs) as raw material and polymerises them to form mRNA according to the complementary bases present on the template DNA«. This process of opening of helix-and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesised mRNA transcripted along with enzyme is released. Another factor called terminator factor is required for the termination of the transcription.

(b) Polymorphism: It is a form of genetic variation in which distinct nucleotide sequence can exist at a particular site in a DNA molecule. This heritable mutation is observed at a high frequency in a population. It arises due to mutation either in somatic cell or in the germ cells. The germ cell mutation can be transmitted from parents to their offsprings. This results in accumulation of various mutations in a population, leading to variation and polymorphism in the population. This plays a very important role in the process of evolution and tracing human history.

(c) Translation: It is the process of polymerising amino acid to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.
The process of translation involves following three steps:

1. Initiation
2. Elongation
3. Termination

During the initiation of the translation, tRNA gets charged when the amino acid binds to it using ATP. The start (initiation) codon (AUG) present on mRNA is recognised only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent amino acids. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The amino acid brought by tRNA gets linked with the previous amino acid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (VAA, UAG, and UGA), the process of translation gets terminated. The polypeptide chain is released and the ribosomes get detached from mRNA.

(d) Bioinformatics: It is the application of computational and statistical techniques to the field of molecular biology. It solves the practical problems arising from the management and analysis of biological data. The field of bioinformatics developed after the completion of human genome project (HGP). This is because enormous amount of data has been generated during the process of HGP that has to be managed and stored for easy access and interpretation for future use by various scientists. Hence, bioinformatics involves the creation of biological databases that store the vast information of biology.

It develops certain tools for easy and efficient access to the information and its utilisation. Bioinformatics has developed new algorithms and statistical methods to find out the relationship between the data, to predict protein structure and their functions, and to cluster the protein sequences into their related families.

Punjab State Board Syllabus PSEB 12th Class Physics Book Solutions Guide Pdf in English Medium and Punjabi Medium are part of PSEB Solutions for Class 12.

PSEB 12th Class Physics Guide | Physics Guide for Class 12 PSEB in English Medium

• Chapter 1 Electric Charges and Fields
• Chapter 2 Electrostatic Potential and Capacitance
• Chapter 3 Current Electricity
• Chapter 4 Moving Charges and Magnetism
• Chapter 5 Magnetism and Matter
• Chapter 6 Electromagnetic Induction
• Chapter 7 Alternating Current
• Chapter 8 Electromagnetic Waves
• Chapter 9 Ray Optics and Optical Instruments
• Chapter 10 Wave Optics
• Chapter 11 Dual Nature of Radiation and Matter
• Chapter 12 Atoms
• Chapter 13 Nuclei
• Chapter 14 Semiconductor Electronics: Materials, Devices and Simple Circuits
• Chapter 15 Communication Systems

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 13 Organisms and Populations Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 13 Organisms and Populations

PSEB 12th Class Biology Guide Organisms and Populations Textbook Questions and Answers

Question 1.
How is diapause different from hibernation?
Answer:
Diapause is a stage of suspended development to cope with unfavourable conditions. Many species of Zooplankton and insects exhibit diapause to tide over adverse climatic conditions during their development. Hibernation or winter sleep is a resting stage wherein animals escape winters of cold) by hiding themselves in their shelters. They escape the winter season by entering a state of inactivity by slowing their metabolism. The phenomenon of hibernation is exhibited by bats, squirrels, and other rodents.

Question 2.
If a marine fish is placed in a freshwater aquarium, will the fish be able to survive? Why or why not?
Answer:
If a marine fish is placed in a freshwater aquarium, then its chances of survival will diminish. This is because their bodies are adapted to high salt concentrations of the marine environment. In freshwater conditions, they are unable to regulate the water entering their body (through osmosis). Water enters their body due to the hypotonic environment outside. This results in the swelling up of the body, eventually leading to the death of the marine fish.

Question 3.
Define phenotypic adaptation. Give one example.
Answer:
Phenotypic adaptation involves changes in the body of an organism in response to genetic mutation or certain environmental changes. These responsive adjustments occur in an organism in order to cope with environmental conditions present in their natural habitats. For example, desert plants have thick cuticles and sunken stomata on the surface of their leaves to prevent transpiration. Similarly, elephants have long ears that act as thermoregulators.

Question 4.
Most living organisms cannot survive at temperatures above 45°C. How are some microbes able to live in habitats with temperatures exceeding 100°C?
Answer:
Archaebacteria (Thermophiles) are ancient forms of bacteria found in hot water springs and deep-sea hydrothermal vents. They are able to survive in high temperatures (which far exceed 100°C) because their bodies have adapted to such environmental conditions. These organisms contain specialised thermo-resistant enzymes, which carry out metabolic functions that do not get destroyed at such high temperatures.

Question 5.
List the attributes that populations but not individuals possess.
Answer:
A population can be defined as a group of individuals of the same species residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans.

The main attributes or characteristics of a population residing in a given area are as follows :
(a) Birth Rate (Natality): It is the ratio of live births in an area to the population of an area. It is expressed as the number of individuals added to the population with respect to the members of the population.

(b) Death Rate (Mortality): It is the ratio of deaths in an area to the population of an area. It is expressed as the loss of individuals with respect to the members of the population.

(c) Sex Ratio: It is the number of males or females per thousand individuals.

(d) Age Distribution: It is the percentage of individuals of different ages in a given population. At any given time, the population is composed of individuals that are present in various age groups. The age distribution pattern is commonly represented through age pyramids.

(e) Population Density: It is defined as the number of individuals of a population present per unit area at a given time.

Question 6.
If a population growing exponentially double in size in 3 years, what is the intrinsic rate of increase (r) of the population?
Answer:
A population grows exponentially if sufficient amounts of food resources are available to the individual. Its exponential growth can be calculated by the following integral form of the exponential growth equation:
N_t = N₀e^rt
where,
N_t = Population density after time t
N₀= Population density at time zero
r = Intrinsic rate of natural increase
e = Base of natural logarithms (2.71828)

From the above equation, we can calculate the intrinsic rate of increase (r) of a population.
Now, as per the question,
Present population density = x
Then, population density after two years = 2x
t = 3 years
Substituting these values in the formula, we get
⇒ 2x = x e^3r
⇒ 2 = e^3r

Applying log on both sides,
⇒ log2 = 3r log e
⇒ \(\frac{\log 2}{3 \log e}\) = r

Hence, the intrinsic rate of increase for the above-illustrated population is 0.2311.

Question 7.
Name important defence mechanisms in plants against herbivory.
Answer:
Several plants have evolved various defence mechanisms both morphological and chemical to protect themselves against herbivory,
(1) Morphological Defence Mechanisms

• Cactus leaves (Opuntia) are modified into sharp spines (thorns) to deter herbivores from feeding on them.
• Sharp thorns along with leaves are present in Acacia to deter herbivores.
• In some plants, the margins of their leaves are spiny or have sharp edges that prevent herbivores from feeding on them.

(2) Chemical Defence Mechanisms

• All parts of Calotropis weeds contain toxic cardiac glycosides, which can prove to be fatal if ingested by herbivores.
• Chemical substances such as nicotine, caffeine, quinine, and opium are produced in plants as a part of self-defence.

Question 8.
An orchid plant is growing on the branch of mango tree. How do you describe this interaction between the orchid and the mango t tree?
Answer:
An orchid plant growing on the branch of a mango tree is an epiphyte. f Epiphytes are plants growing on other plants which however, do not derive nutrition from them. Therefore, the relationship between a mango tree and an orchid is an example of commensalisms, where one species gets benefited while the other remains unaffected. In the above interaction, the orchid is benefited as it gets support while the mango tree remains unaffected.

Question 9.
What is the ecological principle behind the biological control method of managing with pest insects?
Answer:
The basis of various biological control methods is on the concept of predation. Predation is a biological interaction between the predator and the prey, whereby the predator feeds on the prey. Hence, the predators regulate the population of preys in a habitat, thereby helping in the management of pest insects.

Question 10.
Distinguish between the following:
(a) Hibernation and Aestivation
(b) Ectotherms and Endotherms
Answer:
(a) Hibernation and Aestivation

Hibernation	Aestivation
1. Hibernation is a state of reduced activity in some organisms to escape cold winter conditions.	Aesrivarion is a state of reduced activity in some organisms to escape desiccation due to heat in summers.
2. Bears and squirrels inhabiting cold regions are examples of animals that hibernate during winters.	Fishes and snails are examples of organisms aestivating during summers.

(b) Ectotherms and Endotherms

Ectotherms	Endotherms
1. Ectotherms ate cold-blooded animals. Their temperature varies with their surroundings.	Endotherms are warm-blooded animals. They maintain a constant body temperature.
2. Fishes, amphibians, and reptiles are ectothermic animals.	birds and mammals are endothermal animals.

Question 11.
Write a short note on
(a) Adaptations of Desert Plants and Animals
(b) Adaptations of plants to water scarcity
(c) Behavioural adaptations in animals
(d) Importance of light to plants
(e) Effect of temperature or water scarcity and the adaptations of animals.
Answer:
(a) Adaptations of Desert Plants and Animals
(i) Adaptations of Desert Plants: Plants found in deserts are well adapted to cope with harsh desert conditions such as water scarcity and scorching heat. Plants have an extensive root system to tap underground water. They bear thick cuticles and sunken stomata o.i the surface of their leaves to reduce transpiration.

In Opuntia, the leaves are entirely modified into spines and photosynthesis is carried out by green stems. Desert plants have special pathways to synthesise food, called CAM (C₄ pathway). It enables the stomata to remain closed during the day to reduce the loss of water through transpiration.

(ii) Adaptations of Desert Animals: Animals found in deserts such as desert kangaroo rats, lizards, snakes, etc. are well adapted to their habitat. The kangaroo rat found in the deserts of Arizona never drinks water in its life. It has the ability to concentrate its urine to conserve water. Desert lizards and snakes bask in the sun during early morning and burrow themselves in the sand during afternoons to escape the heat of the day. These adaptations occur in desert animals to prevent the loss of water.

(b) Adaptations of Plants to Water Scarcity: Plants found in deserts are well adapted to cope with water scarcity and scorching heat of the desert. Plants have an extensive root system to tap underground water. They bear thick cuticles and sunken stomata on the, surface of their leaves to reduce transpiration. In Opuntia, the leaves are modified into
spines and the process of photosynthesis is carried out by green stems. Desert plants have special pathways to synthesise food, called CAM. (C₄ pathway). It enables their stomata to remain closed during the day to reduce water loss by transpiration.

(c) Behavioural Adaptations in Animals: Certain organisms are affected by temperature variations. These organisms undergo adaptations such as hibernation, aestivation, migration, etc. to escape environmental stress to suit their natural habitat. These adaptations in the behaviour of an organism are called behavioural adaptations. For example, ectodermal animals and certain endotherms exhibit behavioural adaptations. Ectotherms are cold-blooded animals such as fish, amphibians, reptiles, etc.

Their temperature varies with their surroundings. For example, the desert lizard basks in the sun during early hours when the temperature is quite low. However, as the temperature begins to rise, the lizard burrows itself inside the sand to escape the scorching sun. Similar burrowing strategies are exhibited by other desert animals. Certain endotherms (warm-blooded animals) such as birds and mammals escape cold and hot weather conditions by hibernating during winters and aestivating during summers. They hide themselves in shelters such as caves, burrows, etc. to protect against temperature variations.

(d) Importance of Light to Plants: Sunlight acts as the ultimate source of energy for plants. Plants are autotrophic organisms, which need light for carrying out the process of photosynthesis. Light also plays an important role in generating photoperiodic responses! occurring in plants. Plants respond to changes in intensity of light
during various seasons to meet their photoperiodic requirements for flowering. Light also plays an important role in aquatic habitats for ‘ vertical distribution of plants in the sea.

(e) Effect of Temperature or Water Scarcity and the Adaptations of Animals: Temperature is the most important
ecological factor. Average temperature on the Earth varies from one place to another. These variations in temperature affect the distribution of animals on the Earth. Animals that can tolerate a wide range of temperature are called eurythermal. Those which can tolerate a narrow range of temperature are called stenothermal animals.

Animals also undergo adaptations to suit their natural habitats. For example, animals found in colder areas have shorter ears and limbs that prevent the loss of heat from their body. Also, animals found in Polar regions have thick layers of fat below their skin and thick coats of fur to prevent the loss of heat.

Some organisms exhibit various behavioural changes to suit their natural habitat. These adaptations present in the behaviour of an organism to escape environmental stresses are called behavioural adaptations. For example, desert lizards are ectotherms. This means that they do not have a temperature regulatory mechanism to escape temperature variations.

Question 12.
List the various abiotic environmental factors.
Answer:
All non-living components of an ecosystem form abiotic components. It includes factors such as temperature, water, light, and soil.

Question 13.
Give an example for:
(a) An endothermic animal
(b) An ectothermic animal
(c) An organism of benthic zone
Answer:
(a) Endothermic Animal: Birds such as crows, sparrows, pigeons, cranes, etc. and mammals such as bears, cows, rats, rabbits, etc. are endothermic animals.

(b) Ectothermic Animal: Fishes such as sharks, amphibians such as frogs, and reptiles such as tortoises, snakes, and lizards are ectothermic animals.

(c) Organism of Benthic Zone: Decomposing bacteria is an example of an organism found in the benthic zone of a water body.

Question 14.
Define population and community.
Answer:
Population: A population can be defined as a group of individuals of the same species residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans.

Community: A community is defined as a group of individuals of different species, living within a certain geographical area. Such individuals can be similar or dissimilar, but cannot reproduce with the members of other species.

Question 15.
Define the following terms and give one example for each:
(a) Commensalism
(b) Parasitism
(c) Camouflage
(d) Mutualism
(e) Interspecific competition
Answer:
(a) Commensalism: Commensalism is an interaction between two species in which one species gets benefited while the other remains unaffected. An orchid growing on the branches of a mango tree and barnacles attached to the body of whales are examples of commensalisms.

(b) Parasitism: It is an interaction between two species in which one species (usually smaller) gets positively affected, while the other species (usually larger) is negatively affected. An example of this is liver fluke. Liver fluke is a parasite that lives inside the liver of the host body and derives nutrition from it. Hence, the parasite is benefited as it derives nutrition from the host, while the host is negatively affected as the parasite reduces the host fitness, making its body weak.

(c) Camouflage: It is a strategy adopted by prey species to escape their predators. Organisms are cryptically coloured so that they can easily mingle in their surroundings and escape their predators. Many species of frogs and insects camouflage in their surroundings and escape their predators.

(d) Mutualism: It is an interaction between two species in which both species involved are benefited. For example, lichens show a mutual symbiotic relationship between fungi and blue-green algae, where both are equally benefited from each other.

(e) Interspecific Competition: It is an interaction between individuals of different species where both species get negatively affected. For example, the competition between flamingoes and resident fishes in South American lakes for common food resources i.e., zooplankton.

Question 16.
With the help of suitable diagram describe the logistic population growth curve.
Answer:
The logistic population growth curve is commonly observed in yeast cells that are grown under laboratory conditions. It includes five phases: the lag phase, positive acceleration phase, exponential phase, negative acceleration phase, and stationary phase.
(a) Lag Phase: Initially, the population of the yeast cell is very small. This is because of the limited resource present in the habitat.

(b) Positive Acceleration Phase: During this phase, the yeast cell adapts to the new environment and starts increasing its population. However, at the beginning of this phase, the growth of the cell is very limited.

(c) Exponential Phase: During this phase, the population of the yeast cell increases suddenly due to rapid growth. The population grows exponentially due to the availability of sufficient food resources, constant environment, and the absence of any interspecific competition. As a result, the curve rises steeply upwards.

(d) Negative Acceleration Phase: During this phase, the
environmental resistance increases and the growth rate of the population decreases. This occurs due to an increased competition among the yeast cells for food and shelter.

(e) Stationary Phase: During this phase, the population becomes stable. The number of cells produced in a population equals the number of cells that die. Also, the population of the species is said to have reached nature’s carrying capacity in its habitat.

A Verhulst-pearl logistic curve is also known as an S-Shaped growth curve.

Question 17.
Select the statement which explains best parasitism.
(a) One organism is benefited.
(b) Both the organisms are benefited.
(c) One organism is benefited, other is not affected.
(d) One organism is benefited, other is affected.
Answer:
(d) One organism is benefited, other is affected.
Parasitism is an interaction between two species in which one species (parasite) derives benefit while the other species (host) is harmed. For example, ticks and lice (parasites) present on the human body represent this interaction wherein the parasites receive benefit (as they derive nourishment by feeding on the blood of humans). On the other hand, these parasites reduce host fitness and cause harm to the human body.

Question 18.
List any three important characteristics of a population and explain.
Answer:
A population can be defined as a group of individuals of the same species, residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans.
Three important characteristics of a population are as follows :
(a) Birth Rate (Natality): It is the ratio of live births in an area to the population of an area. It is expressed as the number of individuals added to the population with respect to the members of the population.

(b) Death Rate (Mortality): It is the ratio of deaths in an area to the population of an area. It is expressed as the loss of individuals with respect to the members of the population.

(c) Age Distribution: It is the percentage of individuals of different ages in a given population. At any given time, a population is composed of individuals that are present in various age groups. The age distribution pattern is commonly represented through a^e pyramids.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 14 Ecosystem Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 14 Ecosystem

PSEB 12th Class Biology Guide Ecosystem Textbook Questions and Answers

Question 1.
Fill in the blanks.
(a) Plants are called as ……………………………. because they fix carbon dioxide.
(b) In an ecosystem dominated by trees, the pyramid (of numbers) is ………………….. type.
(c) In aquatic ecosystems, the limiting factor for the productivity is ………………………. .
(d) Common detritivores in our ecosystem are …………………………. .
(e) The major reservoir of carbon on earth is …………………………….. .
Answer:
(a) autotrophs
(b) inverted
(c) light
(d) earthworms
(e) oceans.

Question 2.
Which one of the following has the largest population in a food chain?
(a) Producers
(b) Primary consumers
(c) Secondary consumers
(d) Decomposers
Answer:
(a) Producers (decomposers can be maximum but they are excluded from the food chain ).

Question 3.
The second trophic level in a lake is
(a) Phytoplankton
(b) Zooplankton
(c) Benthos
(d) Fishes
Answer:
(b) Zooplankton
Zooplankton are primary consumers in aquatic food chains that feed upon phytoplankton. Therefore, they are present at the second trophic level in a lake.

Question 4.
Secondary producers are
(a) Herbivores
(b) Producers
(c) Carnivores
(d) None of the above
Answer:
(d) None of the above
Plants are the only producers. Thus, they are called primary producers. There are no other producers in a food chain.

Question 5.
What is the percentage of photosynthetically active radiation (PAR) in the incident solar radiation?
(a) 100%
(b) 50 %
(c) 1-5%
Answer:
(b) 50%
Out of total incident solar radiation, about fifty percent of it forms photosynthetically active radiation or PAR.

Question 6.
Distinguish between
(a) Grazing food chain and detritus food chain
(b) Production and decomposition
(c) Upright and inverted pyramid
(d) Food chain and Food web
(e) Litter and detritus
(f) Primary and secondary productivity
Answer:
(a) Grazing food chain and detritus food chain

Grazing food chain	Detritus food chain
1. In this food chain, energy is derived from the Sun.	In this food chain, energy comes from organic matter (or detritus) generated in trophic levels of the grazing food chain.
2. It begins with producers, present at the first trophic level. The plant biomass is then eaten by herbivores, which in turn are consumed by a variety of carnivores.	begins with detritus such as dead bodies of animals or fallen leaves, which are then eaten by decomposers or detrivores. These detritivores are in turn consumed by their predators.
3. This food chain is usually large.	It is usually smaller as compared to the grazing food chain.

(b) Production and decomposition

Production	Decomposition
1. It is the rare of producing organic matter (food) by producers.	It is the process of breaking down of complex organic matter or biomass from the body of dead plants and animals with the help of decomposers into organic raw material such as CO2, H2O and other nutrients.
2. It depends on the photosynthetic cápacity of the producers.	It occurs with the help of decomposers.
3. Sunlight is required by plants for primary production.	Sunlight is not required for decomposition by clecomposers.

(c) upright and inverted pyramid

Upright pyramid	Inverted pyramid
1. The pyramid of energy is upright.	always The pyramid of biomass and the pyramid of, numbers can be inverted.
2. In the upright pyramid, the number and biomass of organisms in the producer level of an ecosystem is the highest, which keeps on decreasing at each trophic level in a food chain.	In an inverted pyramid, the number and biomass of organisms in the producer level of an ecosystem is the lowest, which keeps on increasing at each tropic level.

(d) Food chain and food web

Food chain	Food web
1. The transfer of energy from producers to top consumers through a series of organisms is called food chain.	A number of food chain inter-connected with each other forming a web-like pattern is called food web.
2. One organism holds only one position.	One organism can hold more than one position.
3. The flow of energy can be easily calculated.	The flow of energy is very difficult to calculate.
4. It is always straight and proceed in a progressive straight line.	Instead of straight line, it is a series of branching lines.
5. Competition is limited to members of same trophic level.	Competition is amongst members of same and different trophic levels.

(e) Litter and detritus

Litter	Detritus
l. It is made of dried fallen plant matter.	It is freshly deposited organic matter, i. e. remains of plants and animals.
2. It is found above the ground.	It is found both above and below the ground.

(f) Primary and secondary productivity

Primary productivity	Secondary_productivity
1. Primary productivity is the amount of energy accumulation or amount of biomass produced per unit area over a time period.	Secondary productivity is the rate of formation of new organic matter by consumer.
2.  It is of two types, gross primary productivity (GPP) and net primary productivity (NPP). They are related as: GPP – R = NPP, where R is respiratory losses.	It is also of two types gross secondary productivity (GSP) and net secondary productivity (NSP). They are related as: NSP = GSP – R Where R is respiratory losses.

Question 7.
Describe the components of an ecosystem.
Answer:
An ecosystem is defined as an interacting unit that includes both the biological community as well as the non-living components of an area. The living and the non-living components of an ecosystem interact amongst themselves and function as a unit, which gets evident during the processes of nutrient cycling, energy flow, decomposition, and productivity. There are many ecosystems such as ponds, forests, grasslands, etc.

The two components of an ecosystem are as follows :
(a) Biotic Component: It is the living component of an ecosystem that includes biotic factors such as producers, consumers, decomposers, etc. Producers include plants and algae. They contain chlorophyll pigment, which helps them carry out the process of photosynthesis in the presence of light.

Thus, they are also called converters or transducers. Consumers or heterotrophs are organisms that are directly (primary consumers) or indirectly (secondary and tertiary consumers) dependent on producers for their food. Decomposers include micro-organisms such as bacteria and fungi. They obtain nutrients by breaking down the remains of dead plants and animals.

(b) Abiotic Component: They are the non-living component of an ecosystem such as light, temperature, water, soil, air, inorganic nutrients, etc.

Question 8.
Define ecological pyramids and describe with examples, pyramids of number and biomass.
Answer:
An ecological pyramid is a graphical representation of various ecological parameters such as the number of individuals present at each trophic level, the amount of energy, or the biomass present at each trophic level.
Ecological pyramids represent producers at the base, while the apex represents the top-level consumers present in the ecosystem.
There are three types of pyramids:

1. Pyramid of numbers
2. Pyramid of energy
3. Pyramid of biomass

1. Pyramid of Numbers: It is a graphical representation of the number of individuals present at each trophic level in a food chain of an ecosystem. The pyramid of numbers can be upright or inverted depending on the number of producers. For example, in a grassland ecosystem, the pyramid of numbers is upright.

In this type of a food chain, the number of producers (plants) is followed by the number of herbivores (mice), which in turn is followed by the number of secondary consumers (snakes) and tertiary carnivores (eagles). Hence, the number of individuals at the producer level will be the maximum, while the number of individuals present at top carnivores will be least.

On the other hand, in a parasitic food chain, the pyramid of numbers is inverted. In this type of a food chain, a single tree (producer) provides food to several fruit-eating birds, which in turn support several insect species.

2. Pyramid of Biomass: A pyramid of biomass is a graphical representation of the total amount of living matter present at each trophic level of an ecosystem. It can be upright or inverted. It is upright in grasslands and forest ecosystems as the amount of biomass present at the producer level is higher than at the top carnivore level.
The pyramid of biomass is inverted in a pond ecosystem as the biomass of fishes far exceeds the biomass of zooplankton (upon which they feed).

Question 9.
What is primary productivity? Give brief description of factors that affect primary productivity.
Answer:
It is defined as the amount of organic matter or biomass produced by producers per unit area over a period of time. Primary productivity of an ecosystem depends on the variety of environmental factors such as light, temperature, water, precipitation, etc. It also depends on the availability of nutrients and the availability of plants to carry out photosynthesis.

Question 10.
Define decomposition and describe the processes and products of decomposition.
Answer:
Decomposition is the process that involves the breakdown of complex organic matter or biomass from the body of dead plants and animals with the help of decomposers into inorganic raw materials such as carbon dioxide, water, and other nutrients. The various processes involved in decomposition are as follows :
1. Fragmentation: It is the first step in the process of decomposition. It involves the breakdown of detritus into smaller pieces by the action of detritivores such as earthworms.

2. Leaching: It is a process where the water-soluble nutrients go down into the soil layers and get locked as unavailable salts.

3. Catabolism: It is a process in which bacteria and fungi degrade detritus through various enzymes into smaller pieces.

4. Humification: The next step is humification which leads to the formation of a dark-colored colloidal substance called humus, which acts as reservoir of nutrients for plants.

5. Mineralisation: The humus is further degraded by the action of microbes, which finally leads to the release of inorganic nutrients into the soil. This process of releasing inorganic nutrients from the humus is known as mineralization.

Decomposition produces a dark-colored, nutrient-rich substance called humus. Humus finally degrades and releases inorganic raw materials such as C02, water, and other nutrients in the soil.

Question 11.
Give an account of energy flow in an ecosystem.
Answer:
Energy enters an ecosystem from the Sun. Solar radiations pass through the atmosphere and are absorbed by the Earth’s surface. These radiations help plants in carrying out the process of photosynthesis.
Also, they help maintain the Earth’s temperature for the survival of living organisms. Some solar radiations are reflected by the Earth’s surface.

Only 2-10% of solar energy is captured by green plants (producers) during photosynthesis to be converted into food.
The rate at which the biomass is produced by plants during photosynthesis is termed as ‘gross primary productivity.
When these green plants are consumed by herbivores, only 10% of the stored energy from producers is transferred to herbivores. The remaining 90 % of this energy is used by plants for various processes such as respiration, growth, and reproduction. Similarly, only 10% of the energy of herbivores is transferred to carnivores. This is known as ten percent law of energy flow.

Question 12.
Write important features of a sedimentary cycle in an ecosystem.
Answer:
Sedimentary cycles have their reservoirs in the Earth’s crust or rocks. Nutrient elements are found in the sediments of the Earth. Elements such as sulphur, phosphorus, potassium, and calcium have sedimentary cycles.
Sedimentary cycles are very slow. They take a long time to complete their circulation and are considered as less perfect cycles. This is because during recycling, nutrient elements may get locked in the reservoir pool, thereby taking a very long time to come out and continue circulation. Thus, it usually goes out of circulation for a long time.

Question 13.
Outline salient features of carbon cycling in an ecosystem.
Answer:
The carbon cycle is an important gaseous cycle which has its reservoir pool in the atmosphere.
All living organisms contain carbon as a major body constituent. Carbon is a fundamental element found in all living forms. All biomolecules such as carbohydrates, lipids, and proteins required for life processes are made of carbon.
Carbon is incorporated into living forms through a fundamental process called ‘photosynthesis’.

Photosynthesis uses sunlight and atmospheric carbon dioxide to produce a carbon compound called ‘glucose’.
This glucose molecule is utilised by other living organisms. Thus, atmospheric carbon is incorporated in living forms.
Now, it is necessary to recycle this absorbed carbon dioxide back into the atmosphere to complete the cycle.

There are various processes by which carbon is recycled back into the atmosphere in the form of carbon dioxide gas.
The process of respiration breaks down glucose molecules to produce carbon dioxide gas. The process of decomposition also releases carbon dioxide from dead bodies of plants and animals into the atmosphere. Combustion of fuels, industrialization, deforestation, volcanic eruptions and forest fires act as other major sources of carbon dioxide.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 4 Reproductive Health Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 4 Reproductive Healths

PSEB 12th Class Biology Guide Reproductive Health Textbook Questions and Answers

Question 1.
What do you think is the significance of reproductive health in a society?
Answer:
Reproductive health is the total well being in all aspects of reproduction. It includes physical, emotional, behavioural, and social well being. Sexually transmitted diseases such as AIDS, gonorrhoea, etc. are transferred from one individual to another through sexual contact. It can also lead to unwanted pregnancies.

Hence, it is necessary to create awareness among people, especially the youth, regarding various reproduction related aspects as the young individuals are the future of the country and they are most susceptible of acquiring sexually transmitted diseases. Creating awareness about the available birth control methods, sexually transmitted diseases and their preventive measures, and gender equality will help in bringing up a socially conscious healthy family. Spreading. awareness regarding uncontrolled population growth and social evils among young individuals will help in building up a reproductively healthy society.

Question 2.
Suggest the aspects of reproductive health which need to be given special attention in the present scenario.
Answer:
Reproductive health is the total well being in all aspects of reproduction. The aspects which have to be given special attention in the present scenario are as follows:
1. Counselling and creating awareness among people, especially the youth, about various aspects of reproductive health, such as sexually transmitted diseases, available contraceptive methods, case of pregnant mothers, adolescence, etc.

2. Providing support and facilities such as medical assistance to people during pregnancy, STDs, abortions, contraceptives, infertility, etc. for building a reproductively healthy society.

Question 3.
Is sex education necessary in schools? Why?
Answer:
Yes, introduction of sex education in schools is necessary. It would provide right information to young individuals at the right time about various aspects of reproductive health such as reproductive organs, puberty, and adolescence related changes, safe sexual practices, sexually transmitted diseases, etc.

The young individual or adolescents are more susceptible in acquiring various sexually transmitted diseases. Hence, providing information to them at the right time would help them to lead a reproductively healthy life and also protect them from the myths and misconceptions about various sex related issues.

Question 4.
Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement.
Answer:
Yes, the reproductive health has tremendously improved in India in the last 50 years. The areas of improvement are as follows:

1. Massive child immunisation programme, which has lead to a decrease in the infant mortality rate.
2. Maternal and infant mortality rate, which has been decreased drastically due to better post natal care.
3. Family planning, which has motivated people to have smaller families.
4. Use of contraceptive, which has resulted in a decrease in the rate of sexually transmitted diseases and unwanted pregnancies.

Question 5.
What are the suggested reasons for population explosion?
Answer:
The human population is increasing day by day, leading to population explosion. It is because of the following two major reasons:
(a) Decreased death rate
(b) Increased birth rate and longevity
The death rate has decreased in the past 50 years. The factor leading to decreased death rate and increased birth rate are control of diseases, awareness and spread of education, improvement in medical facilities, ensured food supply in emergency situation, etc. All this has resulted in an increase in the longevity of an individual.

Question 6.
Is the use of contraceptives justified? Give reasons.
Answer:
Yes, the use of contraceptives is absolutely justified. The human population is increasing tremendously. Therefore, to regulate the population growth by regulating reproduction has become a necessary demand in the present times. Various contraceptive devices have been devised to reduce unwanted pregnancies, which help in bringing down the increased birth rate and hence, in checking population explosion.

Question 7.
Removal of gonads cannot be considered as a contraceptive option. Why?
Answer:
Contraceptive devices are used to prevent unwanted pregnancy and to prevent the spreading of STDs. There are many methods, such as natural, barrier, oral, and surgical methods, that prevent unwanted pregnancy. However, the complete removal of gonads cannot be a contraceptive option because it will lead to infertility and unavailability of certain hormones that are required for normal functioning of accessory reproductive parts. Therefore, only those contraceptive methods can be used that prevent the chances of fertilisation rather than making the person infertile forever.

Question 8.
Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment.
Answer:
Amniocentesis is a pre-natal diagnostic technique that is used to determine the sex and metabolic disorders of the developing foetus in the mother’s uterus through the observation of the chromosomal patterns. This method was developed so as to determine any kind of genetic disorder present in the foetus. However, unfortunately, this technique is being misused to detect the sex of the child before birth and the female foetus is then aborted. Thus, to prevent the increasing female foeticides, it is necessary to ban the usage of amniocentesis technique for determining the sex of a child.

Question 9.
Suggest some methods to assist infertile couples to have children.
Answer:
Infertility is the inability of a couple to produce a baby even after unprotected intercourse. It might be due to abnormalities present in either male or female, or might be even both the partners. The techniques used to assist infertile couples to have children are as follows:
(a) Test Tube Babies: This involves in-vitro fertilisation where the sperms meet the egg outside the body of a female. The zygote, hence produced, is then transferred in the uterus or fallopian tube of a normal female. The babies produced from this method are known as test tube babies.

(b) Gamete Intra Fallopian Transfer (GIFT): It is a technique that involves the transfer of gamete (ovum) from a donor into the fallopian tube of the recipient female who is unable to produce eggs, but has the ability to conceive and can provide right conditions for the development of an embryo.

(c) Intra Cytoplasmic Sperm Injection (ICSI): It is a method of injecting sperm directly into the ovum to form an embryo in laboratory.

(d) Artificial Insemination: Artificial insemination is a method of transferring semen (sperm) from a healthy male donor into the vagina or uterus of the recipient female. It is employed when the male partner is not able to inseminate the female or has low sperm counts.

Question 10.
What are the measures one has to take to prevent from contracting STDs?
Answer:
Sexually transmitted diseases (STDs) get transferred from one individual to the other through sexual contact. Adolescents and young adults are at the greatest risk of acquiring these sexually transmitted diseases. Hence, creating awareness among the adolescents regarding its after-effects can prevent them from contracting STDs. The use of contraceptives, such as condoms, etc. while intercourse, can prevent the transfer of these diseases. Also, sex with unknown partners or multiple partners should be avoided as they may have such diseases. Specialists should be consulted immediately in case of doubt so as to assure early detection and cure of the disease.

Question 11.
State True/False with explanation.
(a) Abortions could happen spontaneously too. (True/False)
(b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False)
(c) Complete lactation could help as a natural method of contraception. (True/False)
(d) Creating awareness about sex related aspects is an effective method to improve reproductive health of the people. (True/False)
Answer:
(a) False
Abortion is term given for medical termination of pregnancy.

(b) False
Infertility is defined as the inability of the couple to produce baby even after unprotected coitus. It might occur due to abnormalities/defects in either male or female or both.

(c) False
Complete lactation or lactational amenorrhea is a natural method of contraception. Flowever, it is limited till lactation period, which continues till six months after parturition.

(d) True.

Question 12.
Correct the following statements:
(a) Surgical methods of contraception prevent gamete formation.
(b) All sexually transmitted diseases are completely curable.
(c) Oral pills are very popular contraceptives among the rural women.
(d) In E. T. techniques, embryos are always transferred into the uterus.
Answer:
(a) Surgical methods of contraception prevent the flow of gamete during intercourse.
(b) Some of the sexually transmitted diseases are curable if they are detected early and treated properly. AIDS is still an incurable disease.
(c) Oral pills are very popular contraceptives among urban women.
(d) In embryo transfer technique, 8 celled embryos are transferred into the fallopian tube while more than 8 celled embryos are transferred into the uterus.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 3 Human Reproduction Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 3 Human Reproduction

PSEB 12th Class Biology Guide Human Reproduction Textbook Questions and Answers

Question 1.
Fill in the blanks:
(a) Humans reproduce …………………. .(asexually/sexually)
Answer:
sexually.

(b) Humans are …………………… .(oviparous/viviparous/ovoviviparous)
Answer:
viviparous.

(c) Fertilisation is ………………………. in humans, (external/internal)
Answer:
internal

(d) Male and female gametes are …………………. .(diploid/haploid)
Answer:
haploid.

(e) Zygote is ………………….. .(diploid/haploid)
Answer:
diploid.

(f) The process of release of ovum from a mature follicle is called ……………………. .
Answer:
ovulation.

(g) Ovulation is induced by a hormone called …………………… .
Answer:
luteinising hormone.

(h) The fusion of male and female gametes is called ……………………… .
Answer:
fertilisation.

(i) Fertilisation takes place in ………………… .
Answer:
fallopian tube (ampullary-isthmic junction).

(j) Zygote divides to form ……………….., which is implanted in uterus.
Answer:
blastocyst

(k) The structure which provides vascular connection between foetus and uterus is called …………………… .
Answer:
placenta.

Question 2.
Draw a labelled diagram of male reproductive system.
Answer:

Question 3.
Draw a labelled diagram of female reproductive system.
Answer:

Question 4.
Write two major functions each of testis and ovary.
Answer:
Functions of the testis
(a) They produce male gametes called spermatozoa by the process of spermatogenesis.
(b) The leydig cells of the seminiferous tubules secrete the male sex hormone called testosterone. Testosterone aids the development of secondary sex characteristics in males.

Functions of the ovary
(a) They produce female gametes called ova by the process of oogenesis.
(b) The growing Graafian follicles secrete the female sex hormone called estrogen. Estrogen aids the development of secondary sex characteristics in females.

Question 5.
Describe the structure of a seminiferous tubule.
Answer:
The production of sperms in the testes takes place in a highly coiled structure called the seminiferous tubules. These tubules are located in the testicular lobules. Each seminiferous tubule is lined by germinal epithelium. It is lined on its inner side by two types of cells namely spermatogonia aid sertoli cells respectively. Spermatogonia are male germ cells which produce primary spermatocytes by meiotic divisions. Primary spermatocytes undergo further meiotic division to form secondary spermatocytes and finally, spermatids. Spermatids later metamorphoses into male gametes called spermatozoa. Sertoli cells are known as nurse cells of the testes as they provide nourishment to the germ cells. There are large polygonal cells known as interstitial cells or leydig cells just adjacent to seminiferous tubules. These cells secrete the male hormone called testosterone.

Question 6.
What is spermatogenesis? Briefly describe the process of spermatogenesis.
Answer:
Spermatogenesis is the process of the production of sperms from the immature germ cells in males. It takes place in seminiferous tubules present inside the testes. During spermatogenesis, a diploid spermatogonium (male germ cell) increases its size to form a diploid primary spermatocyte. This diploid primary spermatocyte undergoes first meiotic division (meiosis I), which is a reductional division to form two equal haploid secondary spermatocytes. Each secondary spermatocyte then undergoes second meiotic division (meiosis II) to form two equal haploid spermatids. Hence, a diploid spermatogonium produces four haploid spermatids. These spermatids are transformed into spermatozoa (sperm) by the process called spermiogenesis.

Question 7.
Name the hormones involved in regulation of spermatogenesis.
Answer:
Follicle-stimulating hormones (FSH) and luteinising hormones (LH) are secreted by gonadotropin releasing hormones from the hypothalamus. These hormones are involved in the regulation of the process of spermatogenesis. FSH acts on sertoli cells, whereas LH acts on leydig cells of the testis and stimulates the process of spermatogenesis.

Question 8.
Define spermiogenesis and spermiation.
Answer:
Spermiogenesis : It is the process of transforming spermatids into matured spermatozoa or sperms.
Spermiation : It is ‘the process when mature spermatozoa are released from the sertoli cells into the lumen of seminiferous tubules.

Question 9.
Draw a labelled diagram of sperm.
Answer:

Question 10.
What are the major components of seminal plasma?
Answer:
Semen (produced in males) is composed of sperms and seminal plasma. The major components of the seminal plasma in the male reproductive system are mucus, spermatozoa, and various secretions of accessory glands. The seminal plasma is rich in fructose, calcium, ascorbic acid, and certain enzymes. It provides nourishment and protection to sperms.

Question 11.
What are the major functions of male accessory ducts and glands?
Answer:
The male accessory ducts are vasa efferentia, epididymis, vas deferens, and rete testis. They play an important role in the transport and temporary storage of sperms. On the contrary, male accessory glands are seminal vesicles, prostate glands, and bulbourethral glands. These glands secrete fluids that lubricate the reproductive system and sperms. The sperms get dispersed in the fluid which makes their transportation into the female body easier. The fluid is rich in fructose, ascorbic acid, and certain enzymes. They also provide nutrients and activate the sperm.

Question 12.
What is oogenesis? Give a brief account of oogenesis.
Answer:
Oogenesis is the process of the formation of a mature ovum from the oogonia in females. It takes place in the ovaries. During oogenesis, a diploid oogonium or egg mother cell increases in size and gets transformed into a diploid primary oocyte. This diploid primary oocyte undergoes first meiotic division i.e., meiosis I or reductional division to form two unequal haploid cells. The smaller cell is known as the first polar body, while the larger cell is known as the secondary oocyte. This secondary oocyte undergoes second meiotic division i.e., meiosis II or equational division and gives rise to a second polar body and an ovum. Hence, in the process of oogenesis, a diploid oogonium produces a single haploid ovum while two or three polar bodies are produced.

Question 13.
Draw a labelled diagram of a section through ovary.
Answer:

Question 14.
Draw a labelled diagram of a Graafian follicle.
Answer:

Question 15.
Name the functions of the following:
(a) Corpus luteum
(b) Endometrium
(c) Acrosome
(d) Sperm tail
(e) Fimbriae
Answer:
(a) Corpus Luteum: It is formed from the ruptured Graafian follicle. It secretes progesterone hormone during the luteal phase of the menstrual cycle. A high level of progesterone inhibits the secretions of FSH and LH, thereby preventing ovulation. It also allows the endometrium of the uterus to proliferate and to prepare itself for implantation.

(b) Endometrium: It is the innermost lining of the uterus. It is rich in glands and undergoes cyclic changes during various phases of the menstrual cycle to prepare itself for the implantation of the embryo.

(c) Acrosome: It is a cap-like structure present in the anterior part of the head of the sperm. It contains hyaluronidase enzyme, which hydrolyses the outer membrane of the egg, thereby helping the sperm to penetrate the egg at the time of fertilisation.

(d) Sperm Tail: It is the longest region of the sperm that facilitates the movement of the sperm inside the female reproductive tract.

(e) Fimbriae: They are finger-like projections at the ovarian end of the fallopian tube. They help in the collection of the ovum (after ovulation), which is facilitated by the beating of the cilia.

Question 16.
Identify True/False statements. Correct each false statement to make it true.
(a) Androgens are produced by Sertoli cells. (True/False)
(b) Spermatozoa get nutrition from Sertoli cells. (True/False)
(c) Leydig cells are found in ovary. (True/False)
(d) Leydig cells synthesise androgens. (True/False)
(e) Oogenesis takes place in corpus luteum. (True/False)
(f) Menstrual cycle ceases during pregnancy. (True/False)
(g) Presence or absence of hymen is not a reliable indicator of virginity or sexual experience. (True/False)
Answer:
(a) Androgens are produced by Sertoli cells.
False Correct : Leydig cells.

(b) Spermatozoa get nutrition from Sertoli cells.
True

(c) Leydig cells are found in ovary.
False Correct : spermatogonia.

(d) Leydig cells synthesise androgens.
True

(e) Oogenesis takes place in corpus luteum.
False Correct : ovaries

(f) Menstrual cycle ceases during pregnancy.
True

(g) Presence or absence of hymen is not a reliable indicator of virginity or sexual experience.
True

Question 17.
What is menstrual cycle? Which hormones regulate menstrual cycle? ,
Answer:
The menstrual cycle is a series of cyclic physiologic changes that take place inside the female reproductive tract in primates. The whole cycle takes around 28 days to complete. The end of the cycle is accompanied by the breakdown of uterine endothelium, which gets released in the form of blood and mucus through the vagina. This is known as menses.

The follicle stimulating hormone (FSH), luteinising hormone (LH), L estrogen, and progesterone are the various hormones that regulate the menstrual cycle. The level of FSH and LH secreted from the anterior pituitary gland increases during the follicular phase. FSH secreted under the influence of RH (releasing hormone) from the hypothalamus , stimulates the conversion of a primary follicle into a graafian follicle.

The level of LH increases gradually leading to the growth of follicle and f secretion of estrogen. Estrogen inhibits the secretion of FSH and stimulates the secretion of luteinising hormone. It also causes the thickening of the uterine endometrium. The increased level of LH causes the rupturing of the graafian follicle and release the ovum into the fallopian tube. The ruptured graafian follicle changes to corpus luteum and starts secreting progesterone hormone during the luteal phase.

Progesterone hormone helps in the maintenance and preparation of endometrium for the implantation of the embryo. High levels of progesterone hormone in the blood decrease the secretion of LH and FSH, therefore inhibiting further ovulation.

Question 18.
What is parturition? Which hormones are involved in induction of parturition?
Answer:
Parturition is the process of giving birth to a baby as the development of the foetus gets completed in the mother’s womb. The hormones involved in this process are oxytocin and relaxin. Oxytocin leads to the contraction of smooth muscles of myometrium of the uterus, which directs the full term foetus towards the birth canal. On the other hand, relaxin hormone causes relaxation of the pelvic ligaments and prepares the uterus for child birth.

Question 19.
In our society the women are often blamed for giving birth to [ daughters. Can you explain why this is not correct?
Answer:
All human beings have 23 pairs of chromosomes. Human males have 22 pairs of autosomes and contain one or two types of sex chromosome. They are either X or Y. On the contrary, human females have 22 pairs of autosomes and contain only the X sex chromosome. The sex of an individual is determined by the type of the male gamete (X or Y), which fuses with the X chromosome of the female. If the fertilising sperm is X, then the baby will be a girl and if it is Y, then the baby will be a boy.
Hence, it is incorrect to blame a woman for the gender of the child.

Question 20.
How many eggs are released by a human ovary in a month? How many eggs do you think would have been released if the mother gave birth to identical twins? Would your answer change if the twins bom were fraternal?
Answer:
An ovary releases an egg every month. When two babies are produced in succession, they are called twins. Generally, twins are produced from a single egg by the separation of early blastomeres resulting from the first zygotic cleavage. As a result, the young ones formed will have the same genetic make-up and are thus, called identical twins.

If the twins born are fraternal, then they would have developed from two separate eggs. This happens when two eggs’ (one from each ovary) are released at the same time and get fertilised by two separate sperms. Hence, the young ones developed will have separate genes and are therefore, called non-identical or fraternal twins.

Question 21.
How many eggs do you think were released by the ovary of a female dog which gave birth to 6 puppies?
Answer:
Dogs and rodents are polyovulatory species. In these species, more than one ovum is released from the ovary at the time of ovulation. Hence, six eggs were released by the ovary of a female dog to produce six puppies.